Mouse IL36B/IL1F8 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGD952-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
552bp
Gene Synonym
2310043N20Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interleukin 1 family, member 8 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-1 family member 8(IL1F8) also known as IL36B, is a member of the interleukin 1(IL-1) cytokine family. IL1F8 may contains a 12-stranded beta-trefoil structure. Until recently, the IL-1 family of cytokines includ four members, with three having pro-inflammatory effects such as IL1F8 and the fourth member being an IL-1 receptor antagonist (IL-1Ra). IL-1 family members exert their effects through binding to receptors that belong to the IL-1 receptor (IL-1R) family. IL1F8 exerts proinflammatory effects in primary human joint cells. Joint and serum IL-1F8 protein levels did not correlate with inflammation, but they were high in some human serum samples tested, including samples from patients with rheumatoid arthritis. IL1F8 also activated NK-κB.
References
  • Magne D, et al. (2006) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. Arthritis Research & Therapy. 8: R80.
  • Smith DE, et al. (2000) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. The Journal of Biological Chemistry. 275: 1169-75.
  • TOP