Rat IL2/IL-2/Interleukin-2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_053836.1

RefSeq ORF Size

468bp

Gene Synonym

IL2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin-2, also known as T-cell growth factor, TCGF, Aldesleukin and IL2, is a secreted protein which belongs to the IL-2 family. Interleukin-2 / IL-2 was the first interleukin molecule to be discovered. Interleukin-2 / IL-2 molecule was first purified to homogeneity by immunoaffinity chromatography by Kendall Smith and his team at Dartmouth Medical School. Interleukin-2 / IL-2 was also the first cytokine shown to mediate its effects via a specific IL-2 receptor, and it was also the first interleukin to be cloned and expressed from a complementary DNA (cDNA) library. Interleukin-2 / IL-2 was designated number 2 because Smith's data at the time indicated that IL-1, produced by macrophages, facilitates IL-2 production by T lymphocytes (T cells).
Interleukin-2 / IL-2 is produced by T-cells in response to antigenic or mitogenic stimulation, this protein is required for T-cell proliferation and other activities crucial to regulation of the immune response. Interleukin-2 / IL-2 is normally produced by the body during an immune response. When environmental substances (molecules or microbes) gain access to the body, these substances (termed antigens) are recognized as foreign by antigen receptors that are expressed on the surface of lymphocytes. Antigen binding to the T cell receptor (TCR) stimulates the secretion of Interleukin-2 / IL-2, and the expression of IL-2 receptors IL-2R. The IL-2 / IL-2R interaction then stimulates the growth, differentiation and survival of antigen-selected cytotoxic T cells via the activation of the expression of specific genes. Interleukin-2 / IL-2 can stimulate B-cells, monocytes, lymphokine-activated killer cells, natural killer cells, and glioma cells. The World Reference Standard for Interleukin-2 / IL-2 is produced by the National Institute of Biological Standards and Control in the UK. A recombinant form of Interleukin-2 / IL-2 for clinical use is manufactured by Chiron Corporation with the brand name Proleukin. It has been approved by the Food and Drug Administration (FDA) for the treatment of cancers (malignant melanoma, renal cell cancer), and is in clinical trials for the treatment of chronic viral infections, and as a booster (adjuvant) for vaccines. The use of Interleukin-2 / IL-2 in HIV therapy has been found to be ineffective.

References

Smith KA, et al.,1980, J. Exp. Med.151 (6): 1551-6.

Smith KA, et al.,1980, Nature. 287 (5785): 853-5.

Taniguchi T, et al.,1983, Nature. 302 (5906): 305.

Cantrell DA, et al.,1984, Science. 224 (4655): 1312-6.

Smith KA, et al.,1988, Science. 240 (4856): 1169-76.

Wang X. et al., 2005, Science 310:1159-63.

Stauber D.J. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 2788-93.

Catalog Number:MGD943-NY