Rhesus IL18RAP Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001108108.2

RefSeq ORF Size

1797bp

Gene Synonym

IL18RAP

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus interleukin 18 receptor accessory protein Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin 18 receptor accessory protein, also known as IL18RAP and CDw218b (cluster of differentiation w218b), is an accessory subunit of the heterodimeric receptor for IL18. This protein enhances the IL18 binding activity of IL18R1 (IL1RRP), a ligand binding subunit of IL18 receptor. The coexpression of IL18R1 and this protein is required for the activation of NF-kappaB and MAPK8 (JNK) in response to IL18. IL18RAP is required for the high affinity binding of interleukin 18 (IL-18) to its receptor complex. IL18RAP together with IL18R1 mediates IL-18-dependent activation of NF-kappa-B and JNK. Two putative isoforms of IL18RAP were detected and the ratios and total levels of these isoforms may contribute to the aetiology of coeliac disease. IL18R1 and IL18RAP polymorphisms have been found associated with diseases such as schizophrenia, HSV1 seropositivity and atopic asthma. Analysis of IL18R1 and IL18RAP SNPs in 5 European prospective cohorts suggests that the variability of these genes are unlikely to contribute to modulate the risk of CVD in European populations.

References

Zhernakova A, et al.. (2008) Genetic analysis of innate immunity in Crohn's disease and ulcerative colitis identifies two susceptibility loci harboring CARD9 and IL18RAP. Am J Hum Genet. 82(5): 1202-10.

Grisoni ML, et al.. (2009) Lack of association between polymorphisms of the IL18R1 and IL18RAP genes and cardiovascular risk: the MORGAM Project. BMC Med Genet. 10: 44.

Koskinen LL, et al.. (2009) Association study of the IL18RAP locus in three European populations with coeliac disease. Hum Mol Genet. 18(6): 1148-55.

Catalog Number:MGD934-NY