Rat IL13RA1/IL-13RA1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGD921-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1281bp
Gene Synonym
MGC105309, LOC100360218, Il13ra1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 13 receptor, alpha 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 13 receptor, alpha 1, also known as IL13RA1/IL-13RA1 and CD213A1 (cluster of differentiation 213A1), is a subunit of the interleukin 13 receptor. This subunit forms a receptor complex with IL4 receptor alpha, a subunit shared by IL13 and IL4 receptors. IL13RA1/IL-13RA1 serves as a primary IL13-binding subunit of the IL13 receptor, and may also be a component of IL4 receptors. This protein has been shown to bind tyrosine kinase TYK2, and thus may mediate the signaling processes that lead to the activation of JAK1, STAT3 and STAT6 induced by IL13 and IL4. IL13RA1/IL-13RA1 binds with low affinity to interleukin-13 (IL13). This subunit together with IL4RA can form a functional receptor for IL13. IL13RA1/IL-13RA1 also serves as an alternate accessory protein to the common cytokine receptor gamma chain for interleukin-4 (IL4) signaling, but cannot replace the function of IL2RG in allowing enhanced interleukin-2 (IL2) binding activity.
References
  • Kawakami M, et al. (2002) Mutation and functional analysis of IL-13 receptors in human malignant glioma cells. Oncol Res. 12 (11-12): 459-67.
  • Umeshita-Suyama R, et al. (2000) Characterization of IL-4 and IL-13 signals dependent on the human IL-13 receptor alpha chain 1: redundancy of requirement of tyrosine residue for STAT3 activation. Int Immunol. 12 (11): 1499-509.
  • He JQ, et al. (2003) Polymorphisms in the IL13, IL13RA1, and IL4RA genes and rate of decline in lung function in smokers. Am J Respir. Cell Mol Biol. 28 (3): 379-85.
  • TOP