Mouse IL12A / IL-12A transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:MGD915-NH

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
711bp
Gene Synonym
p35, Ll12a, Il-12a, IL-12p35
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interleukin 12a transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-12 subunit alpha (IL12A/IL-12p35) is also known as Cytotoxic lymphocyte maturation factor 35 kDa subunit, cytotoxic lymphocyte maturation factor 1, p35, NK cell stimulatory factor chain 1, and interleukin-12 alpha chain. IL12A/IL-12p35 is a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. IL12A/IL-12p35 is required for the T-cell-independent induction of IFN-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. In clinical, IL-12 remains a very promising immunotherapeutic agent because recent cancer vaccination studies in animal models and humans have demonstrated its powerful adjuvant properties. The immune modulating characteristics of IL-12 considered responsible for the adjuvant effects, as well as the results of animal and human cancer vaccination studies with IL-12 applied as an adjuvant. IL12A/IL-12p35 indicates a cytokine which is important in the development of prostate cancer.
References
  • Sattler HP, et al. (2000) Novel amplification unit at chromosome 3q25-q27 in human prostate cancer. Prostate. 45(3): 207-15.
  • Lamont AG, et al. (1996) IL-12: a key cytokine in immune regulation. Immunol Today. 17(5): 214-7.
  • Portielje JE, et al. (2003) IL-12: a promising adjuvant for cancer vaccination. Cancer Immunol Immunother. 52(3): 133-44.
  • TOP