Rat IL-9 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGD906-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
435bp
Gene Synonym
IL9
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 9 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 9, also known as IL-9, is a cytokine (cell signalling molecule) belonging to the group of interleukins. IL-9 is a cytokine that acts as a regulator of a variety of hematopoietic cells. This cytokine stimulates cell proliferation and prevents apoptosis. It functions through the interleukin 9 receptor (IL-9R), which activates different signal transducer and activator (STAT) proteins and thus connects this cytokine to various biological processes. Genetic studies on a mouse model of asthma demonstrated that this cytokine is a determining factor in the pathogenesis of bronchial hyperresponsiveness. IL-9 is a key molecule that affects differentiation of TH17 cells and Treg function. IL-9 predominantly produced by TH17 cells, synergizes with TGF-β1 to differentiate naïve CD4+ T cells into TH17 cells, while IL-9 secretion by TH17 cells is regulated by IL-23. Interestingly, IL-9 enhances the suppressive functions of FoxP3+ CD4+ Treg cells in vitro, and absence of IL-9 signaling weakens the suppressive activity of nTregs in vivo, leading to an increase in effector cells and worsening of experimental autoimmune encephalomyelitis. The mechanism of IL-9 effects on TH17 and Tregs is through activation of STAT3 and STAT5 signaling. Our findings highlight a role of IL-9 as a regulator of pathogenic versus protective mechanisms of immune responses.
References
  • Elyaman W, et al. (2009) IL-9 induces differentiation of TH17 cells and enhances function of FoxP3+ natural regulatory T cells. Proc Natl Acad Sci U S A. 106(31): 12885-90.
  • Dong Q, et al. (1999) IL-9 induces chemokine expression in lung epithelial cells and baseline airway eosinophilia in transgenic mice. Eur J Immunol. 29(7): 2130-9.
  • Kimura Y, et al. (1995) Sharing of the IL-2 receptor gamma chain with the functional IL-9 receptor complex. Int Immunol. 7(1): 115-20.
  • TOP