Mouse IL-28B/IFN-lambda-3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGD898-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
582bp
Gene Synonym
Il28, IFL-1, Il28b, IL-28B, INF-alpha, INF-lambda
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interferon lambda 3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-28B (IL-28B) also known as Interferon lambda-3 and IFN-lambda-3, belongs to the type III interferon family of cytokines and are highly similar to IL-29. IL-28B belongs to the newly described interferon lambda (IFNλ) family of cytokines. IL-28B is a cytokine with immunomodulatory activity. It functions in Up-regulating MHC class I antigen expression. IL-28B displays potent antiviral activity and antitumor activity. This cytokine serves as ligand for the heterodimeric class II cytokine receptor composed of IL10RB and IL28RA. The ligand/receptor complex seems to signal through the Jak-STAT pathway. IL-28B, like IL-12, is capable of robustly enhancing adaptive immunity. Moreover, we describe for the first time how IL-28B reduces regulatory T-cell populations during DNA vaccination, whereas IL-12 increases this cellular subset. We also show that IL-28B, unlike IL-12, is able to increase the percentage of splenic CD8+ T cells in vaccinated animals, and that these cells are more granular and have higher antigen-specific cytolytic degranulation compared with cells taken from animals that received IL-12 as an adjuvant.
References
  • Ge D, et al.. (2009) Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature. 461(7262): 399-401.
  • Morrow MP, et al.. (2009) Comparative ability of IL-12 and IL-28B to regulate Treg populations and enhance adaptive cellular immunity. Blood. 113(23): 5868-77.
  • Sheppard P, et al.. (2003) IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol. 4(1): 63-8.
  • TOP