Rat IL-27 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGD896-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
705bp
Gene Synonym
RGD1561420, Il27
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 27 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
IL-27 protein is a member of the IL-6 superfamily, which is expressed on monocytes, endothelial cells and dendritic cells. IL-27 protein is also referred as the IL-12 p35-related protein, p28, is one subunit of a heterodimeric cytokine complex, and associates with another subunit EBI3 (EBV-induced gene 3), an IL-12 p40-related protein (IL-27B). IL-27 protein is an early product of activated antigen-presenting cells and drives rapid clonal expansion of naive CD4(+) T cells and plays a role in the early regulation of Th1 cells initiation which drives efficient adaptive immune response. IL-27 protein has an antiproliferative activity on melanomas through WSX-1/STAT1 signaling. Thus, IL-27 protein may be an attractive candidate as an antitumor agent applicable to cancer immunotherapy.
References
  • Hisada M, et al. (2004) Potent antitumor activity of interleukin-27. Cancer Res. 64(3): 1152-6.
  • Larousserie F, et al. (2005) Analysis of interleukin-27 (EBI3/p28) expression in Epstein-Barr virus- and human T-cell leukemia virus type 1-associated lymphomas: heterogeneous expression of EBI3 subunit by tumoral cells. Am J Pathol. 166(4): 1217-28.
  • Seita J, et al. (2008) Interleukin-27 directly induces differentiation in hematopoietic stem cells. Blood. 111(4): 1903-12.
  • TOP