Rat IL-23/IL-23A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_130410.2

RefSeq ORF Size

591bp

Gene Synonym

MGC114275, Il23a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat Interleukin 23, alpha subunit p19 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

IL-23, which is mainly secreted by antigen-presenting cells, is a member of the IL-12 family, which includes IL-12, IL-27, and IL-35[10]. IL-23 is a heterodimeric cytokine, comprised a unique p19 subunit and p40 subunit, the latter of which is shared with IL-12. The receptor for IL-23 consists of IL-23R and IL-12Rβ1, the latter of which is also characteristic of IL-12. IL-23 is essential for Th17 differentiation, expansion, and survival by binding to its receptor, thereby activating the signaling pathway [11,12]. Many studies revealed that the IL-23/Th17 pathway is implicated in the pathophysiology of various autoimmune diseases, such as autoimmune arthritis[13], primary biliary cirrhosis[14], and inflammatory bowel disease[15].

References

Ye X, Zhang L, Wang H, et al. The Role of IL-23/Th17 Pathway in Patients with Primary Immune Thrombocytopenia. Kuwana M, ed. PLoS ONE. 2015;10(1):e0117704.

Catalog Number:MGD894-CM