Rat IL-22BP/IL-22RA2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001003404.1

RefSeq ORF Size

690bp

Gene Synonym

Crf2-s1, Il22ra2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 22 receptor, alpha 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin-22 receptor subunit alpha-2 (IL-22RA2), also known as interleukin-22-binding protein (IL-22BP), is a subunit of the receptor for interleukin 22. IL-22BP belongs to the type I I cytokine receptor family and contains 3 fibronectin type-III domains. IL-22BP/IL-22RA2 is expressed in a range of tissues, including those in the digestive, female reproductive, and immune systems. It is expressed in placenta, spleen, breast, skin and lung. It is also detected in intestinal tract, testis, brain, heart and thymus. The dominant cell types expressing IL-22BP/IL-22RA2 were mononuclear cells and epithelium. IL-22BP/IL-22RA2 may play an important role as an IL-22 antagonist in the regulation of inflammatory responses. Interleukin-22 (IL-22) is a member of IL-10 family. It is produced by T cells and induces the production of acute-phase reactants. IL-22 plays important roles in immune response through activation of the STAT 3 signal transduction pathway. Two types of IL-22-binding receptor have been discovered, a membrane-bound receptor and a soluble receptor.

References

Whittington HA, et al. (2004) Interleukin-22: a potential immunomodulatory molecule in the lung. Am J Respir Cell Mol Biol. 31(2): 220-6.

Dumoutier L, et al. (2001) Cloning and characterization of IL-22 binding protein, a natural antagonist of IL-10-related T cell-derived inducible factor/IL-22. J Immunol. 166(12): 7090-5.

Wei CC, et al. (2003) Cloning and characterization of mouse IL-22 binding protein. Genes Immun. 4(3): 204-11.

Catalog Number:MGD891-NM