Rat IL-17F Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001015011.1

RefSeq ORF Size

462bp

Gene Synonym

IL17F

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 17F Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin-17F (IL-17F) is a cytokine that shares sequence similarity with IL17. The most notable role of IL-17 is it involvement in inducing and mediating proinflammatory responses. IL-17 is commonly associated with allergic responses. IL-17F is expressed by activated T cells, and was expressed only in activated CD4+ T cells and activated monocytes. IL-17F has been shown to stimulate the production of several other cytokines, including IL6 and IL8. This cytokine is also found to inhibit the angiogenesis of endothelial cells and induce endothelial cells to produce IL2, TGFB1/TGFB, and monocyte chemoattractant protein-1. Recombinant human IL-17F did not stimulate the proliferation of hematopoietic progenitors or the migration of mature leukocytes. However, it markedly inhibited the angiogenesis of human endothelial cells and induced endothelial cells to produce IL-2, TGF-{beta}, and monocyte chemoattractant protein-1. IL-17F stimulates the production of other cytokines and granulocyte colony-stimulating factor, and can regulate cartilage matrix turnover. IL-17F stimulates PBMC and T-cell proliferation. It also function in inhibiting angiogenesis By similarity. IL-17F plays a role in the induction of neutrophilia in the lungs and in the exacerbation of antigen-induced pulmonary allergic inflammation.

References

et al..

Starnes T, et al.. (2001) Cutting edge: IL-17F, a novel cytokine selectively expressed in activated T cells and monocytes, regulates angiogenesis and endothelial cell cytokine production. J Immunol. 167(8): 4137-40.

Hymowitz SG, et al.. (2001) IL-17s adopt a cystine knot fold: structure and activity of a novel cytokine, IL-17F, and implications for receptor binding. EMBO J. 20(19): 5332-41.

McAllister F, et al.. (2005) Role of IL-17A, IL-17F, and the IL-17 receptor in regulating growth-related oncogene-alpha and granulocyte colony-stimulating factor in bronchial epithelium: implications for airway inflammation in cystic fibrosis. J Immunol. 175(1): 404-12.

Catalog Number:MGD878-NM