Mouse IGF1/IGF‑I/IGF-1 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGD836-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
480bp
Gene Synonym
Igf-1, Igf-I, C730016P09Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse insulin-like growth factor 1 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
IGF I, also known as mechano growth factor, somatomedin-C, IGF-I and IGF1, is a secreted protein which belongs to the?insulin family. The insulin family, comprised of insulin, relaxin, insulin-like growth factors I and II ( IGF-I and IGF-II ) and possibly the beta-subunit of 7S nerve growth factor, represents a group of structurally related polypeptides whose biological functions have diverged. The IGFs, or somatomedins, constitute a class of polypeptides that have a key role in pre-adolescent mammalian growth. IGF-I expression is regulated by GH and mediates postnatal growth, while IGF-II appears to be induced by placental lactogen during prenatal development. IGF1 / IGF-I may be a physiological regulator of [1-14C]-2-deoxy-D-glucose (2DG) transport and glycogen synthesis in osteoblasts. IGF1 / IGF-I stimulates glucose transport in rat bone-derived osteoblastic (PyMS) cells and is effective at much lower concentrations than insulin, not only regarding glycogen and DNA synthesis but also with regard to enhancing glucose uptake. Defects in IGF1 / IGF-I are the cause of insulin-like growth factor I deficiency (IGF1 deficiency) which is an autosomal recessive disorder characterized by growth retardation, sensorineural deafness and mental retardation.
References
TOP