Rat IFNGR1/CD119 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_053783.1

RefSeq ORF Size

1395bp

Gene Synonym

Ifngr, Ifngr1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interferon gamma receptor 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD119 (cluster of differentiation 119), also known as IFNGR1 ( interferon gamma receptor 1), is part of the heterodimeric gamma interferon receptor which consists of IFNGR1 (CD119) and IFNGR2. The IFNGR1 gene encodes the ligand-binding chain (alpha) of the interteron receptor while IFNGR gene encodes the non-ligand binding partner. The ability of the interferon-γ was achieved through binding to the interferon receptor CD119. After binding, the products of activated T-lymphocytes interferon-γ exerts antiviral activity, growth inhibitory effect, and several immune- regulatory activities on a variety of cell types.

References

Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.

Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.

Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12

Novick D, et al. (1987) The human interferon-gamma receptor. The journal of biological chemistry. 262 (18): 8483-7

Catalog Number:MGD819-CO