Mouse I-TAC / CXCL11 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_019494.1

RefSeq ORF Size

303bp

Gene Synonym

IP9, H174, ITAC, b-R1, CXC11, I-TAC, SCYB9B, Scyb11, betaR1, Cxcl11

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 11 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

I-TAC, also known as CXCL11, is a small cytokine belonging to the CXC chemokine family. It is highly expressed in peripheral blood leukocytes, pancreas and liver, with moderate levels in thymus, spleen and lung and low expression levels were in small intestine, placenta and prostate. The I-TAC chemokine elicits its effects on its target cells by interacting with the cell surface chemokine receptor CXCR3, with a higher affinity than do the other ligands for this receptor, CXCL9 and CXCL10. I-TAC is chemotactic for activated T cells. The CXCL11 gene is located on human chromosome 4 along with many other members of the CXC chemokine family.

References

Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.

Rani MR, et al. (2002) Requirement of phosphoinositide 3-kinase and Akt for interferon-beta-mediated induction of the beta-R1 (SCYB11) gene. J Biol Chem. 277(41): 38456-61.

Salmaggi A, et al. (2003) Expression and modulation of IFN-gamma-inducible chemokines (IP-10, Mig, and I-TAC) in human brain endothelium and astrocytes: possible relevance for the immune invasion of the central nervous system and the pathogenesis of multiple sclerosis. J Interferon Cytokine Res. 22(6):631-40.

Catalog Number:MGD770-CO