Human I-309/CCL1/TCA-3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGD769-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
291bp
Gene Synonym
CCL1, P500, SISe, TCA3, I-309, SCYA1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CCL1 or chemokine (C-C motif) ligand 1, also known as I-309 or TCA-3, is a member of the chemokine (C-C motif) ligand family. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands (CCL)-1 to 28. I-309/CCL1/TCA-3 interacts with the G protein-linked transmembrane chemokine receptors CCR8, and induces biochemical events that may result in the control of chemotaxis, proliferation, apoptosis and adhesion. It has been demonstrated that I-309/CCL1/TCA-3 displays chemotactic activity for monocytes and other cell types such as NK cells and dendritic cells, but not for neutrophils. Furthermore, as the only known physiological ligand for CCR8, I-309/CCL1/TCA-3 was identified as a potent inhibitor of HIV-1 envelope-mediated cell-cell fusion and virus infection. I-309/CCL1/TCA-3 induce significant levels of LTC4 from elicited eosinophils.
References
  • Miller MD, et al. (1992) The human cytokine I-309 is a monocyte chemoattractant. Proc Natl Acad Sci. 89 (7): 2950-4.
  • Roos RS, et al. (1997) Identification of CCR8, the receptor for the human CC chemokine I-309. J Biol Chem. 272 (28): 17251-4.
  • Oliveira SH, et al. (2002) Increased responsiveness of murine eosinophils to MIP-1beta (CCL4) and TCA-3 (CCL1) is mediated by their specific receptors, CCR5 and CCR8. J Leukoc Biol. 71(6): 1019-25.
  • TOP