Mouse HMGN3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGD655-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
234bp
Gene Synonym
TRIP7; BB071015; 1110002A15Rik; 6330514M13Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse high mobility group nucleosomal binding domain 3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
HMGN3 belongs to the HMGN family and is expressed in kidney, lung, pancreas, testis, skeletal muscle, heart, thyroid gland, pituitary gland, prostate and uterus. Members of the HMGN family bind to nucleosomes without any specificity for the underlying DNA sequence. They affect the global and local structure of chromatin, as well as the levels of histone modifications and thus play a role in epigenetic regulation of gene expression. HMGN3 regulates the expression of the glucose transporter SLC2A2 by binding specifically to its promoter region and recruiting PDX1 and additional transcription factors. It also regulates the expression of SLC6A9, a glycine transporter which regulates the glycine concentration in synaptic junctions in the central nervous system, by binding to its transcription start site. Both insulin and glucagon levels can be affected by HMGN3. HMGN3 may play a role in ocular development and astrocyte function. It also modulates the expression of pancreatic genes involved in insulin secretion.
References
  • Ueda T, et al. (2009) The nucleosome binding protein HMGN3 modulates the transcription profile of pancreatic beta cells and affects insulin secretion. Mol Cell Biol. 29(19):5264-76.
  • Lei SF, et al. (2012) Genome-wide association study identifies HMGN3 locus for spine bone size variation in Chinese. Hum Genet. 131(3):463-9.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • TOP