Rat HGF/Hepatocyte Growth Factor Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_017017.2

RefSeq ORF Size

2187bp

Gene Synonym

HPTA

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat hepatocyte growth factor Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Hepatocyte growth factor, also known as HGF, contains 4 kringle domains, 1 PAN domain and 1 peptidase S1 domain. It belongs to the peptidase S1 family, plasminogen subfamily. Hepatocyte growth factor is secreted by mesenchymal cellsas a single inactive polypeptide and is cleaved by serine proteases into a 69-kDa alpha-chain and 34-kDa beta-chain. A disulfide bond between the alpha and beta chains produces the active, heterodimeric molecule. Hepatocyte growth factor regulates cell growth, cell motility, and morphogenesis by activating a tyrosine kinase signaling cascade after binding to the proto-oncogenic c-Met receptor, and acts as a multi-functional cytokine on cells of mainly epithelial origin. Its ability to stimulate mitogenesis, cell motility, and matrix invasion gives it a central role in angiogenesis, tumorogenesis, and tissue regeneration. HGF is a potent mitogen for mature parenchymal hepatocyte cells, seems to be an hepatotrophic factor, and acts as growth factor for a broad spectrum of tissues and cell types. HGF has no detectable protease activity. Defects in hepatocyte growth factor are the cause of deafness autosomal recessive type 39. A form of profound prelingual sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

References

Naldini L, et al. (1991) Scatter factor and hepatocyte growth factor are indistinguishable ligands for the MET receptor. EMBO J. 10(10):2867-78.

Comoglio, et al. (1993) Structure, biosynthesis and biochemical properties of the HGF receptor in normal and malignant cells. 65:131-65.

Hahn W, et al. (2011) Enhanced cardioprotective effects by coexpression of two isoforms of hepatocyte growth factor from naked plasmid DNA in a rat ischemic heart disease model. The Journal of Gene Medicine. 13(10):549-55.

Bottaro DP, et al. (1991) Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science. 251(4995):802-4.

Catalog Number:MGD561-CM