Mouse HDAC8 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGD507-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1134bp
Gene Synonym
2610007D20Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse histone deacetylase 8 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Histone deacetylase 8, also known as HDAC8 and HDACL1, is a nucleus and cytoplasm protein which belongs to the histone deacetylase family and HD type 1 subfamily. Histone deacetylases (HDACs) are a growing family of enzymes implicated in transcriptional regulation by affecting the acetylation state of core histones in the nucleus of cells. HDAC8 / HDACL1 is weakly expressed in most tissues. It expressed at higher level in heart, brain, kidney and pancreas and also in liver, lung, placenta, prostate and kidney. HDAC8 / HDACL1 is responsible for the deacetylation of lysine residues on the N-terminal part of the core histones ( H2A, H2B, H3 and H4 ). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. HDAC8 / HDACL1 may play a role in smooth muscle cell contractility. HDAC8 / HDACL1 may be a potential drug target for neuroblastoma differentiation therapy using selective inhibitors, avoiding unspecific side effects.
References
  • Buggy JJ. et al.,2000, Biochem J. 350 (1): 199-205.
  • Krennhrubec K. et al., 2007, Bioorg Med Chem Lett. 17 (10): 2874-8.
  • Oehme I. et al., 2009, Expert Opin Investig Drugs.18 (11): 1605-17.
  • TOP