Mouse HDAC3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGD506-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1287bp
Gene Synonym
AW537363
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse histone deacetylase 3 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Histone Deacetylases (HDACs) are a group of enzymes closely related to sirtuins. They catalyze the removal of acetyl groups from lysine residues in histones and non-histone proteins, resulting in transcriptional repression. In general, they do not act autonomously but as components of large multiprotein complexes, such as pRb-E2F and mSin3A, that mediate important transcription regulatory pathways. There are three classes of HDACs; classes 1, 2 and 4, which are closely related Zn2+-dependent enzymes. HDACs are ubiquitously expressed and they can exist in the nucleus or cytosol. Their subcellular localization is effected by protein-protein interactions (for example HDAC-14.3.3 complexes are retained in the cytosol) and by the class to which they belong (class 1 HDACs are predominantly nuclear whilst class 2 HDACs shuttle between the nucleus and cytosol). HDACs have a role in cell growth arrest, differentiation and death and this has led to substantial interest in HDAC inhibitors as possible antineoplastic agents. Histone Deacetylases (HDACs) is Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. Probably participates in the regulation of transcription through its binding to the zinc-finger transcription factor YY1; increases YY1 repression activity. Required to repress transcription of the POU1F1 transcription factor. Acts as a molecular chaperone for shuttling phosphorylated NR2C1 to PML bodies for sumoylation.
References
  • Emiliani S, et al. (1998) Characterization of a human RPD3 ortholog, HDAC3. Proc Natl Acad Sci. 95 (6): 2795-800.
  • Dangond F, et al. (1998) Differential display cloning of a novel human histone deacetylase (HDAC3) cDNA from PHA-activated immune cells. Biochem Biophys Res Commun. 242 (3): 648-52.
  • Nicolas E, et al. (2001) The histone deacetylase HDAC3 targets RbAp48 to the retinoblastoma protein. Nucleic Acids Res. 29 (15): 3131-6.
  • TOP