Mouse HBEGF Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_010415.1

RefSeq ORF Size

627bp

Gene Synonym

DTS, Dtr, Hegfl, HB-EGF, AW047313, MGC107656, Hbegf

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse heparin-binding EGF-like growth factor Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Heparin-binding EGF-like growth factor (HBEGF), a member of the EGF family of growth factors, exerts its biological activity through activation of the EGFR and other ErbB receptors. Soluble mature HBEGF is proteolytically processed from a larger membrane-anchored precursor and is a potent mitogen and chemotactic factor for fibroblasts, smooth muscle cells but not endothelial cells. HBEGF activates two EGF receptor subtypes, HER1 and HER4 and binds to cell surface HSPG. The transmembrane form of HBEGF is a juxtacrine growth and adhesion factor and is uniquely the receptor for diphtheria toxin. Both forms of HB-EGF participate in normal physiological processes and in pathological processes including tumor progression and metastasis, organ hyperplasia, and atherosclerotic disease. HBEGF participates in diverse biological processes, including heart development and maintenance, skin wound healing, eyelid formation, blastocyst implantation, progression of atherosclerosis and tumor formation, through the activation of signaling molecules downstream of ErbB receptors and interactions with molecules associated with HBEGF. tumor necrosis factor-alpha (TNF-alpha) and interleukin-1 beta markedly increased HB-EGF mRNA levels in HUVEC by 12- and 7-fold, respectively, and induction of the gene by TNF-alpha was both dose- and time-dependent.

References

Miyamoto S, et al. (2006) Heparin-binding epidermal growth factor-like growth factor as a novel targeting molecule for cancer therapy. Cancer Sci. 97(5): 341-7.

Raab G, et al. (1997) Heparin-binding EGF-like growth factor. Biochim Biophys Acta. 1333(3): 179-99.

Pathak BG, et al. (1995) Mouse chromosomal location of three EGF receptor ligands: amphiregulin (Areg), betacellulin (Btc), and heparin-binding EGF (Hegfl). Genomics. 28(1): 116-8.

Catalog Number:MGD492-CF