Human GSK3B Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_001146156.1

RefSeq ORF Size

1263bp

Gene Synonym

GSK3B

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human glycogen synthase kinase 3 beta Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

GSK3B is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It Contains 1 protein kinase domain, and is expressed in testis, thymus, prostate and ovary and weakly expressed in lung, brain and kidney. GSK3B is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in GSK3B gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. GSK3B participates in the Wnt signaling pathway. It is implicated in the hormonal control of several regulatory proteins including glycogen synthase, MYB and the transcription factor JUN. Phosphorylates JUN at sites proximal to its DNA-binding domain, thereby reducing its affinity for DNA. Phosphorylates MUC1 in breast cancer cells, and decreases the interaction of MUC1 with CTNNB1/beta-catenin. GSK3B also plays an important role in ERBB2-dependent stabilization of microtubules at the cell cortex. It prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. GSK3B phosphorylates MACF1 and this phosphorylation inhibits the binding of MACF1 to microtubules which is critical for its role in bulge stem cell migration and skin wound repair. It may be required for early embryo development and neuron differentiation.

References

Bergmann C, et al. (2011) Inhibition of glycogen synthase kinase 3β induces dermal fibrosis by activation of the canonical Wnt pathway. Ann Rheum Dis. 70(12):2191-8.

Ban JO, et al. (2011) Troglitazone, a PPAR agonist, inhibits human prostate cancer cell growth through inactivation of NFκB via suppression of GSK-3β expression. Cancer Biol Ther. 12(4):288-96.

Tsukigi M, et al. (2012) Re-expression of miR-199a suppresses renal cancer cell proliferation and survival by targeting GSK-3β. Cancer Lett. 315(2):189-97.

Nandan D, et al. (2012) Myeloid cell IL-10 production in response to leishmania involves inactivation of glycogen synthase kinase-3β downstream of phosphatidylinositol-3 kinase. J Immunol. 188(1):367-78.

Catalog Number:MGD312-CM