Mouse GRK5 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_018869.3

RefSeq ORF Size

1773bp

Gene Synonym

Gprk5, Grk5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse G protein-coupled receptor kinase 5 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

G protein-coupled receptor kinase 5, also known as G protein-coupled receptor kinase GRK5 and GRK5, is a member of the protein kinase superfamily, AGC Ser/Thr protein kinase family and GPRK subfamily. GRKs specifically phosphorylate agonist-occupied G protein-coupled receptors at the inner surface of the plasma membrane (PM), leading to receptor desensitization. GRKs utilize a variety of mechanisms to bind tightly, and sometimes reversibly, to cellular membranes. GRKs play an important role in mediating agonist-specific desensitization of numerous G protein-coupled receptors.
GRK5 contains one AGC-kinase C-terminal domain, one protein kinase domain and one RGS domain. GRK5 specifically phosphorylates the activated forms of G protein-coupled receptors. Phospholipid-stimulated autophosphorylation may represent a novel mechanism for membrane association and regulation of GRK5 activity. GRK5 deficiency significantly exaggerates microgliosis and astrogliosis in the presence of an inflammatory initiator, such as the excess fibrillar Abeta and the subsequent active inflammatory reactions. GRK5 deficiency has been linked to early Alzheimer's disease in humans and mouse models of the disease.

References

Kunapuli,P. et al., 1994, J Biol Chem. 269 (14):10209-12.

Millman,E.E. et al., 2004, Br J Pharmacol 141 (2):277-84.

Thiyagarajan,M.M. et al., 2004, J Biol Chem 279 (17):17989-95.

Suo,Z. et al., 2007,Neurobiol Aging. 28 (12):1873-88.

Li,L. et al., 2008,J Neuroinflammation. 5 :24.

Catalog Number:MGD302-NO