Mouse GREM1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGD290-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
555bp
Gene Synonym
ld, Drm, Cktsf1b1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse gremlin 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GREM1 belongs to the DAN family. It contains 1 CTCK (C-terminal cystine knot-like) domain. GREM1 is a cysteine knot-secreted protein and acts as an inhibitor in the TGF beta signaling pathway. It inhibits BMP-2, -4, and -7. Inhibition by grem 1 of BMPs in mice allow the expression of fibroblast growth factors (FGFs) 4 and 8 and Sonic hedgehog (SHH) which are necessary for proper limb development. It interacts with SLIT1 and SLIT2 in a glycosylation-dependent manner. As a cytokine, GREM1 may play an important role during carcinogenesis and metanephric kidney organogenesis, as a BMP antagonist required for early limb outgrowth and patterning in maintaining the FGF4-SHH feedback loop. It down-regulates the BMP4 signaling in a dose-dependent manner. It also acts as inhibitor of monocyte chemotaxis. GREM1 is highly expressed in small intestine, fetal brain and colon.
References
  • Dimitrov BI, et al. (2010) Genomic rearrangements of the GREM1-FMN1 locus cause oligosyndactyly, radio-ulnar synostosis, hearing loss, renal defects syndrome and Cenani--Lenz-like non-syndromic oligosyndactyly. J Med Genet. 47(8):569-74.
  • Heron M, et al. (2011) Genetic variation in GREM1 is a risk factor for fibrosis in pulmonary sarcoidosis. Tissue Antigens. 77(2):112-7.
  • van Vlodrop IJ, et al. (2010) Prognostic significance of Gremlin1 (GREM1) promoter CpG island hypermethylation in clear cell renal cell carcinoma. Am J Pathol. 176(2):575-84.
  • TOP