Rat GPT1/GPT Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_031039.1

RefSeq ORF Size

1491bp

Gene Synonym

Gpt1, Gpt

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat glutamic-pyruvate transaminase (alanine aminotransferase) Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Alanine aminotransferase (ALT), also known as glutamate pyruvate transaminase (GPT), is a pyridoxal enzyme which belongs to the class-I pyridoxal-phosphate-dependent aminotransferase family, Alanine aminotransferase subfamily. Gpt / Gpt1 / ALT catalyses the reversible interconversion of L-alanine and 2-oxoglutalate to pyruvate and L-glutamate, and plays a key role in the intermediary metabolism of glucose and amino acids. Gpt / Gpt1 / ALT is expressed in Liver, kidney, heart, and skeletal muscles and it expresses at moderate levels in the adipose tissue. As a key enzyme for gluconeogenesis, Gpt is a widely-used serum marker for liver injury. Two ALT isoenzymes have been identified, ALT1 and ALT2 (GPT1 and GPT2), which are encoded by separate genes and share significant sequence homology, but differ in their expression patterns. GPT1/GPT is widely distributed and mainly expressed in intestine, liver, fat tissues, colon, muscle, and heart, in the order of high to low expression level. Serum activity levels of this enzyme are routinely used as a biomarker of liver injury caused by drug toxicity, infection, alcohol, and steatosis.

References

Bergmeyer HU, et al. (1978) Optimization of methods for aspartate aminotransferase and alanine aminotransferase. Clin Chem. 24(1): 58-73.

King MC, et al. (1980) Allele increasing susceptibility to human breast cancer may be linked to the glutamate-pyruvate transaminase locus. Science. 208(4442): 406-8.

Prati D, et al. (2002) Updated definitions of healthy ranges for serum alanine aminotransferase levels. Ann Intern Med. 137(1): 1-10.

Catalog Number:MGD275-CM