Mouse GPNMB/Osteoactivin Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_008486.1

RefSeq ORF Size

1725bp

Gene Synonym

ipd, Dchil, DC-HIL

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse glycoprotein (transmembrane) nmb Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

GPNMB belongs to the PMEL / NMB family, also known as Osteoactivin and Hematopoietic growth factor-inducible neurokinin 1 ( HGFIN ), is a transmembrane glycoprotein that is expressed in numerous cells, including osteoclasts, macrophages, dendritic cells, and tumor cells. It is suggested to influence osteoblast maturation, cell adhesion and migration. GPNMB protein acts as a downstream mediator of BMP-2 effects on osteoblast differentiation and function. GPNMB participates in bone mineralization, and functions as a negative regulator of inflammation in macrophages. Osteoactivin is expressed at high levels in normal and inflammatory liver macrophages suggesting a significant role in acute liver injury. The early-phase upregulation of Osteoactivin expression in the tubular epithelium in response to renal injury might play a role in triggering renal interstitial fibrosis via activation of matrix metalloproteinase expression and collagen remodeling in rats. Osteoactivin as a protein that is expressed in aggressive human breast cancers and is capable of promoting breast cancer metastasis to bone.

References

Pahl MV. et al., 2010, Clin J Am Soc Nephrol. 5(1): 56-61.

Abdelmagid SM. et al., 2008, Exp Cell Res. 314(13): 2334-51.

Haralanova-Ilieva B. et al., 2005, J Hepatol. 242(4): 565-72.

Abdelmagid SM. et al., 2007, J Cell Physiol. 210(1): 26-37.

Furochi H. et al., 2007, J Med Invest. 54(3-4): 248-54.

Catalog Number:MGD246-CF