Rat GM-CSF/CSF2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGD157-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
435bp
Gene Synonym
Gmcsf, Gm-csf, Csf2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat colony stimulating factor 2 (granulocyte-macrophage) Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is one of an array of cytokines with pivotal roles in embryo implantation and subsequent development. Several cell lineages in the reproductive tract and gestational tissues synthesise GM-CSF under direction by ovarian steroid hormones and signalling agents originating in male seminal fluid and the conceptus. The pre-implantation embryo, invading placental trophoblast cells and the abundant populations of leukocytes controlling maternal immune tolerance are all subject to GM-CSF regulation. GM-CSF stimulates the differentiation of hematopoietic progenitors to monocytes and neutrophils, and reduces the risk for febrile neutropenia in cancer patients. GM-CSF also has been shown to induce the differentiation of myeloid dendritic cells (DCs) that promote the development of T-helper type 1 (cellular) immune responses in cognate T cells. The active form of the protein is found extracellularly as a homodimer, and the encoding gene is localized to a related gene cluster at chromosome region 5q31 which is known to be associated with 5q-syndrome and acute myelogenous leukemia. As a part of the immune/inflammatory cascade, GM-CSF promotes Th1 biased immune response, angiogenesis, allergic inflammation, and the development of autoimmunity, and thus worthy of consideration for therapeutic target. GM-CSF has been utilized in the clinical management of multiple disease processes. Most recently, GM-CSF has been incorporated into the treatment of malignancies as a sole therapy, as well as a vaccine adjuvant. While the benefits of GM-CSF in this arena have been promising, recent reports have suggested the potential for GM-CSF to induce immune suppression and, thus, negatively impact outcomes in the management of cancer patients. GM-CSF deficiency in pregnancy adversely impacts fetal and placental development, as well as progeny viability and growth after birth, highlighting this cytokine as a central maternal determinant of pregnancy outcome with clinical relevance in human fertility.
References
  • Robertson SA. (2007) GM-CSF regulation of embryo development and pregnancy. Cytokine Growth Factor Rev. 18(3-4): 287-98.
  • Waller EK. (2007) The role of sargramostim (rhGM-CSF) as immunotherapy. Oncologist. 12 Suppl 2: 22-6.
  • Clive KS, et al. (2010) Use of GM-CSF as an adjuvant with cancer vaccines: beneficial or detrimental? Expert Rev Vaccines. 9(5): 519-25.
  • TOP