Mouse GLO1/Glyoxalase 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_025374.3

RefSeq ORF Size

555bp

Gene Synonym

GLY1, Qglo, Glo-1, Glo-1r, Glo-1s, Glo1-r, Glo1-s, AW550643, 0610009E22Rik, 1110008E19Rik, 2510049H23Rik, Glo1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse glyoxalase 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Lactoylglutathione lyase, also known as Methylglyoxalase, Aldoketomutase, Glyoxalase I, Ketone-aldehyde mutase, S-D-lactoylglutathione methylglyoxal lyase and GLO1, is a member of the glyoxalase I family. GLO1 / Glyoxalase I is a ubiquitous cellular defense enzyme involved in the detoxification of methylglyoxal, a cytotoxic byproduct of glycolysis. Accumulative evidence suggests an important role of GLO1 expression in protection against methylglyoxal-dependent protein adduction and cellular damage associated with diabetes, cancer, and chronological aging. GLO1 / Glyoxalase I has been implicated in anxiety-like behavior in mice and in multiple psychiatric diseases in humans. GLO1 / Glyoxalase I catalyzes the conversion of hemimercaptal, formed from methylglyoxal and glutathione, to S-lactoylglutathione. GLO1 / Glyoxalase I exists in three separable isoforms which originate from two alleles in the genome. These correspond to two homodimers and one heterodimer composed of two subunits showing different electrophoretic properties. GLO1 upregulation may play a functional role in glycolytic adaptations of cancer cells.

References

Wu, YY. et al., 2008,Prog Neuropsychopharmacol Biol Psychiatry. 32 (7):1740-4.

Williams,R. et al., 2009, PLoS One 4 (3): e4649.

Antognelli,C. et al., 2009, BMC Cancer 9 :115.

Bair,W.B. et al., 2010, Melanoma Res 20 (2):85-96.

Catalog Number:MGD128-NM