Rat GFRA1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_012959.1

RefSeq ORF Size

1407bp

Gene Synonym

Gfra1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat GDNF family receptor alpha 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 1 (GFRA1) is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA1 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. GDNF, a distantly related member of the transforming growth factor-β (TGF-â) superfamily, and its receptor components: GFRA1, Ret and neural cell adhesion molecule (NCAM) have been recently reported to be expressed in the testis and to be involved in the proliferation regulation of immature Sertoli cells.

References

Jing S, et al. (1997) GFRalpha-2 and GFRalpha-3 are two new receptors for ligands of the GDNF family. J Biol Chem. 272(52): 33111-7.

Jing S, et al. (1996) GDNF-induced activation of the ret protein tyrosine kinase is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell. 85(7):1113-24.

Treanor JJ, et al. (1996) Characterization of a multicomponent receptor for GDNF. Nature. 382(6586): 80-3.

Catalog Number:MGD086-CF