Human GADD45G / CR6 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGC987-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
480bp
Gene Synonym
RP11-260L6.1, CR6, DDIT2, GADD45gamma, GRP17, GADD45G
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human growth arrest and DNA-damage-inducible, gamma Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GADD45G, also known as CR6, is part of the nuclear proteins to interact with various proteins whose transcript levels are raised after stressful growth arrest conditions and treatment with DNA-damaging agents. GADD45G reacts to environmental stresses by mediating activation of the p38/JNK pathway which is mediated through their protein binding and activating MTK1/MEKK4 kinase, which is an upstream activator of both p38 and JNK MAPKs. GADD45G acts as a new-age tumor suppressor however is being frequently inactivated epigenetically in multiple tumors. GADD45G mRNA expression is down-regulated in hepatocellular carcinoma. GADD45G causes cell cycle arrest at G2/M transition when transfected into Hep-G2 cells. GADD45G induction by androgens involves new protein synthesis. Overexpression of GADD45G inhibits cell growth and causes morphological modifications in prostate cell lines thus GADD45G takes part in differentiation induction by androgens.
References
  • Takekawa M. et al., 1998, Cell. 95 (4): 521-30.
  • Suzuki M. et al., 1999, J Hum Genet. 44 (5): 300-3.
  • Azam N. et al., 2001, J Biol Chem. 276 (4): 2766-74.
  • TOP