Rat Fractalkine/CX3CL1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:MGC900-NG

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1182bp
Gene Synonym
Cx3c, Scyd1, Cx3cl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat chemokine (C-X3-C motif) ligand 1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fractalkine or Chemokine (C-X3-C motif) ligand 1 (CX3CL1) is a member of the CX3C chemokine family. Fractalkine / CX3CL1 is a unique chemokine that functions not only as a chemoattractant but also as an adhesion molecule and is expressed on endothelial cells activated by proinflammatory cytokines, such as interferon-gamma and tumor necrosis factor-alpha. Fractalkine/CX3CL1 is expressed in a membrane-bound form on activated endothelial cells and mediates attachment and firm adhesion of T cells, monocytes and NK cells. Fractalkine / CX3CL1 is associated with dendritic cells (DC) in epidermis and lymphoid organs. The fractalkine receptor, CX3CR1, is expressed on cytotoxic effector lymphocytes, including natural killer (NK) cells and cytotoxic T lymphocytes, which contain high levels of intracellular perforin and granzyme B, and on macrophages. Soluble fractalkine causes migration of NK cells, cytotoxic T lymphocytes, and macrophages, whereas the membrane-bound form captures and enhances the subsequent migration of these cells in response to secondary stimulation with other chemokines.
References
  • Imai T, et al. (1997) Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell. 91(4): 521-30.
  • Papadopoulos EJ, et al. (1999) Fractalkine, a CX3C chemokine, is expressed by dendritic cells and is up-regulated upon dendritic cell maturation. Eur J Immunol. 29 (8): 2551-9.
  • Umehara H, et al. (2004) Fractalkine in vascular biology: from basic research to clinical disease". Arterioscler. Thromb Vasc Biol. 24 (1): 34-40.
  • TOP