Mouse FLRG/Fstl3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGC867-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
771bp
Gene Synonym
Flrg, E030038F23Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse follistatin-like 3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Follistatin-like 3 (FLRG/Fstl3) is a secreted glycoprotein of the follistatin-module-protein family. It may have a role in leukemogenesis. FLRG/Fstl3 is a recently described member of the FST family having an overall structure and activity profile similar to that of FST, including binding and neutralization of activin. FLRG/Fstl3 is expressed in a wide range of adult tissues, not detected in hematopoietic cells except in patients with a B cell chronic leukemia and a translocation. Isoform 1 or the secreted form is a binding and antagonizing protein for members of the TGF-beta family, such us activin, BMP2 and MSTN. Inhibits activin A-, activin B-, BMP2- and MSDT-induced cellular signaling; more effective on activin A than on activin B. Involved in bone formation; inhibits osteoclast differentiationc. Involved in hematopoiesis; involved in differentiation of hemopoietic progenitor cells, increases hematopoietic cell adhesion to fibronectin and seems to contribute to the adhesion of hematopoietic precursor cells to the bone marrow stroma. Isoform 2 of FLRG/Fstl3 or the nuclear form of FLRG/Fstl3 is probably involved in transcriptional regulation via interaction with MLLT10. Modulation of activin and other TGFβ superfamily signaling is the primary mechanism of action for both follistatin (FS) and FS-like 3 (FSTL-3). FLRG/Fstl3 is likely to be a local regulator of activin action in gonadal development and gametogenesis and, further, that activin appears to have important actions in gonadal development and function that are critical for normal reproduction.
References
  • Sidis Y, et al. (2006) Biological activity of follistatin isoforms and follistatin-like-3 is dependent on differential cell surface binding and specificity for activin, myostatin, and bone morphogenetic proteins. Endocrinology. 147(7): 3586-97.
  • Schneyer A, et al. (2003) Differential binding and neutralization of activins A and B by follistatin and follistatin like-3 (FSTL-3/FSRP/FLRG). Endocrinology. 144(5): 1671-4.
  • Xia Y, et al. (2004) Overexpression of follistatin-like 3 in gonads causes defects in gonadal development and function in transgenic mice. Mol Endocrinol. 18(4): 979-94.
  • TOP