Mouse Fibroblast Activation Protein alpha/FAP Gene ORF cDNA clone expression plasmid,N terminal His tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007986.2

RefSeq ORF Size

2286bp

Gene Synonym

Fap

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse fibroblast activation protein Gene ORF cDNA clone expression plasmid,N terminal His tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-His

Restriction Site

Protein Tag

His

Tag Sequence

CACCATCACCACCATCATCACCACCATCAC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Seprase, also known as 170 kDa melanoma membrane-bound gelatinase , Fibroblast activation protein alpha, Integral membrane serine protease and FAP, is a single-pass type II membrane protein which belongs to the peptidase S9B family. Seprase / FAP is found in cell surface lamellipodia, invadopodia and on shed vesicles. Seprase / FAP appears to act as a proteolytically active 170-kDa dimer, consisting of two 97-kDa subunits. It is a member of the group type II integral serine proteases, which includes dipeptidyl peptidase IV ( DPPIV / CD26 ) and related type II transmembrane prolyl serine peptidases, which exert their mechanisms of action on the cell surface. Seprase / FAP colocalized with DPP4 in invadopodia and lamellipodia of migratory activated endothelial cells in collagenous matrix. Seprase / FAP colocalized with DPP4 on endothelial cells of capillary-like microvessels but not large vessels within invasive breast ductal carcinoma. DPP4 and seprase exhibit multiple functions due to their abilities to form complexes with each other and to interact with other membrane-associated molecules. In association with DPP4, Seprase / FAP is involved in the pericellular proteolysis of the extracellular matrix (ECM), the migration and invasion of endothelial cells into the ECM. Seprase / FAP has a dual function in tumour progression. The proteolytic activity of Seprase has been shown to promote cell invasiveness towards the ECM and also to support tumour growth and proliferation. Seprase / FAP may have a role in tissue remodeling during development and wound healing, and may contribute to invasiveness in malignant cancers.

References

Mori,Y. et al., 2004, Oncology. 67 (5-6):411-9.

Aertgeerts K., et al., 2005, J. Biol. Chem. 280:19441-19444.

Liu T., et al., 2005, J. Proteome Res. 4:2070-2080.

Ghersi G., et al., 2006, Cancer Res. 66:4652-4661.

O'Brien,P. et al., 2008, Biochim Biophys Acta. 1784 (9):1130-45.

Catalog Number:MGC835-NH