Canine FGF21 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Canine

NCBI Ref Seq

XM_541510.2

RefSeq ORF Size

639 bp

Gene Synonym

FGF21

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine fibroblast growth factor 21 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

HindIII + XbaI(6kb+0.64kb)

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Fibroblast growth factor 21 (FGF21) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF-21 has a hydrophobic amino terminus, which is a typical signal sequence, and appears to be a secreted protein. The metabolic regulator fibroblast growth factor 21 (FGF21) has antidiabetic properties in animal models of diabetes and obesity. FGF21 is a novel adipokine associated with obesity-related metabolic complications in humans. The paradoxical increase of serum FGF21 in obese individuals, which may be explained by a compensatory response or resistance to FGF21, warrants further investigation. FGF-21, which we have identified as a novel metabolic factor, exhibits the therapeutic characteristics necessary for an effective treatment of diabetes.

References

Zhang X, et al. (2008) Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes. 57(5): 1246-53.

Lundåsen T, et al. (2007) PPARalpha is a key regulator of hepatic FGF21. Biochem Biophys Res Commun. 360(2): 437-40.

Kharitonenkov A, et al. (2005) FGF-21 as a novel metabolic regulator. J Clin Invest. 115(6): 1627-35.

Catalog Number:MGC806-NY