Canine FGF18 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGC803-CM

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
624bp
Gene Synonym
FGF18
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Canine fibroblast growth factor 18 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fibroblast growth factor 18 (FGF18) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. It has been shown in vitro that FGF18 is able to induce neurite outgrowth in PC12 cells. Studies of the similar proteins in mouse and chick suggested that this protein is a pleiotropic growth factor that stimulates proliferation in a number of tissues, most notably the liver and small intestine. Experiment datas identified FGF18 as a selective ligand for FGFR3 in limb bud mesenchymal cells, which suppressed proliferation and promoted their differentiation and production of cartilage matrix. FGF18 appears to regulate cell proliferation and differentiation positively in osteogenesis and negatively in chondrogenesis.
References
  • Ohbayashi N, et al. (2002) FGF18 is required for normal cell proliferation and differentiation during osteogenesis and chondrogenesis. Genes Dev. 16(7): 870-9.
  • Davidson D, et al. (2005) Fibroblast growth factor (FGF) 18 signals through FGF receptor 3 to promote chondrogenesis. J Biol Chem. 280(21): 20509-15.
  • Liu Z, et al. (2007) FGF18 is required for early chondrocyte proliferation, hypertrophy and vascular invasion of the growth plate. Dev Biol. 302(1): 80-91.
  • TOP