Mouse FCRL1/FCRH1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGC770-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
903bp
Gene Synonym
Bxmh1, Fcrh1, Ifgp1, Bxmas1, Bxmh1b, Fcrh1l, Fcrh1s, A230020G22Rik, Fcrl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Fc receptor-like 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fc receptor-like protein 1, also known as FcR-like protein 1, Fc receptor homolog 1, IFGP family protein 1, Immune receptor translocation-associated protein 5 and FCRL1, is a single-pass type I  membrane protein which contains three Ig-like C2-type (immunoglobulin-like) domains. It is a cell-surface membrane protein belonging to FCRL family and is preferentially expressed on B cells. FCRL1 is primarily expressed in secondary lymphoid tissues by mature subsets of B cells. It is detected in spleen, lymph node, heart, skeletal muscle, kidney, liver and placenta. FCRL1 is specifically expressed by mature B lineage cells with higher expression in naive versus memory B cells (at protein level). Human Fc receptor-like molecules (FCRL1, FCRL2, FCRL3, FCRL4, FCRL5) have tyrosine-based immunoregulatory potential and are expressed by B-lineage subpopulations. FCRL1 may function as an activating coreceptor in B cells. It may also function in B cells activation and differentiation.
References
  • Du X. et al., 2008, Blood. 111 (1): 338-43.
  • Kazemi T. et al., 2008, Int J Cancer. 123 (9): 2113-9.
  • Baranov K. et al., 2008, J Immunol Methods. 332 (1-2): 73-81.
  • TOP