Mouse FcERI/FCER1A Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_010184.2

RefSeq ORF Size

753bp

Gene Synonym

FcERI, Fce1a, Fcr-5, fcepsilonri, Fcer1a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse Fc receptor, IgE, high affinity I, alpha polypeptide Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

FcERI, also known as FCER1A, is the alpha subunit of the immunoglobulin epsilon receptor (IgE receptor). IgE receptor is a high affinity IgE receptor which plays a central role in allergic disease, coupling allergen and mast cell to initiate the inflammatory and immediate hypersensitivity responses that are characteristic of disorders such as hay fever and asthma. The allergic response occurs when 2 or more IgE receptors are crosslinked via IgE molecules that in turn are bound to an allergen (antigen) molecule. A perturbation occurs that brings about the release of histamine and proteases from the granules in the cytoplasm of the mast cell and leads to the synthesis of prostaglandins and leukotrienes--potent effectors of the hypersensitivity response. IgE receptor is comprised of an alpha subunit(FcERI), a beta subunit, and two gamma subunits. FcERI is glycosylated and contains 2 Ig-like (immunoglobulin-like) domains.

References

Shikanai T, et al. (2002) Sequence variants in the FcepsilonRI alpha chain gene. J Appl Physiol. 93(1):37-41.

Sada K, et al. (2002) Regulation of FcepsilonRI-mediated degranulation by an adaptor protein 3BP2 in rat basophilic leukemia RBL-2H3 cells. Blood. 100(6):2138-44.

Takahashi K, et al. (2003) Transcriptional regulation of the human high affinity IgE receptor alpha-chain gene. Mol Immunol. 38(16-18):1193-9.

Catalog Number:MGC765-NM