Mouse FAM3D / Oit1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_146050.2

RefSeq ORF Size

672bp

Gene Synonym

EF-7, Fam3d, AV067083, MGC37550, 2310076N21Rik, Oit1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse oncoprotein induced transcript 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Family with sequence similarity 3 (FAM3) family is a novel cytokine-like gene family, which has four genes in this family, FAM3A, FAM3B, FAM3C, and FAM3D, each encoding a protein (224-235 amino acids) with a hydrophobic leader sequence. It had indicated that FAM3B/PANDER (pancreatic derived factor) is highly expressed in pancreas, and FAM3A and FAM3C in almost all tissues. FAM3D is abundantly expressed in placenta and weakly expressed in small intestine. Immunohistochemistry showed that FAM3A is expressed prominently in the vascular endothelium, particularly capillaries. FAM3A and FAM3B protein were both localized to the islets of Langerhans of the endocrine pancreas. Recombinant FAM3B protein has delayed effects on beta-cell function. FAM3C is involved in retinal laminar formation processes in vertebrates. NFATC2, SCP2, CACNA1C, TCRA, POLE, and FAM3D, were associated with narcolepsy. Some of these associations were further supported by gene expression analyses and an association study in essential hypersomnia (EHS), CNS hypersonia similar to narcolepsy.

References

Zhu Y, et al. (2002) Cloning, expression, and initial characterization of a novel cytokine-like gene family. Genomics. 80(2): 144-50.

Katahira T, et al. (2010) Secreted factor FAM3C (ILEI) is involved in retinal laminar formation. Biochem Biophys Res Commun. 392(3): 301-6.

Shimada M, et al. (2010) An approach based on a genome-wide association study reveals candidate loci for narcolepsy. Hum Genet. 128(4): 433-41.

Catalog Number:MGC693-NY