Mouse FAM19A2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGC680-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
408bp
Gene Synonym
TAFA2, Tafa-2, AI851790, 6330575M02, FAM19A2TAFA-2, Fam19a2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse family with sequence similarity 19, member A2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FAM19A2 belongs to the FAM19/TAFA family. FAM19/TAFA family members are chemokine-like proteins. The biological functions of TAFA family members remain to be determined, but there are a few tentative hypotheses. First, TAFAs may modulate immune responses in the CNS by functioning as brain specific chemokines, and may act with other chemokines to optimize the recruitment and activity of immune cells in the CNS. Second, TAFAs may represent a novel class of neurokines that act as regulators of immune nervous cells. And third, TAFAs may control axonal sprouting following brain injury. Human FAM19A2 is 97% aa identical to mouse FAM19A2 and is expressed in the central nervous system (CNS), colon, heart, lung, spleen, kidney, and thymus, however its expression in the CNS is 50 to 1000 fold higher than in other tissues. FAM19A2 gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins.
References
  • Parsa A, et al. (2011) Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. Clin Transl Sci. 4(1):17-23.
  • Rose JE, et al. (2010) Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. Mol Med. 16(7-8):247-53.
  • Trynka G, et al. (2009) Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. Gut. 58(8):1078-83.
  • TOP