Mouse FABP4 /A-FABP Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGC639-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
399bp
Gene Synonym
Ap2, Lbpl, 422/aP2, ALBP/Ap2, Fabp4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse fatty acid binding protein 4, adipocyte Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fatty acid-binding protein, adipocyte, also known as Adipocyte-type fatty acid-binding protein, Fatty acid-binding protein 4, Adipocyte lipid-binding protein, and FABP4, is a cytoplasm protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. In familial combined hyperlipidemia (FCHL), FABP4 correlated to body mass index (BMI), waist circumference and homeostasis model assessment (HOMA) index.FABP4 levels were associated with triglyceride-rich lipoproteins. In humans serum FABP4 levels correlate significantly with features of PCOS. It appears to be a determinant of atherogenic dyslipidemia. FABP4 pathway mediates the sebaceous gland hyperplasia in keratinocyte-specific Pten-null mice. FABP4 concentration significantly increased with an increasing of MS features and was strongly correlated with body-mass index, triglycerides, HDL-cholesterol concentrations and blood pressure. Patients in the highest quartile of FABP4 presented a six-fold increased odds ratio for MS and a three-fold increased odds for LD, adjusted by age, sex, body-mass index and the antiretroviral therapy. FABP4 is a strong plasma marker of metabolic disturbances in HIV-infected patients, and therefore, could serve to guide therapeutic intervention in this group of patients.
References
  • van Dongen,M.J. et al., 2002, J Am Chem Soc. 124 (40): 11874-80.
  • Coll, B. et al., 2008, Atherosclerosis  199 (1):147-53.
  • Hoashi,S. et al., 2008, BMC Genet. 9 :84.
  • Cai,H. et al., 2010, Bioorg Med Chem Lett  20 (12):3675-9.
  • TOP