Human Esterase D/ESD Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGC594-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
849bp
Gene Synonym
RP11-147L20.1, FGH, FLJ11763, ESD
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human esterase D Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Esterase D, also known as ESD, is a serine hydrolase that belongs to the esterase D family. Esterase D is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. Esterase D gene is used as a genetic marker and a diagnostic tool for retinoblastoma, Wilson's disease and other hereditary or acquired diseases controlled by genes located at the 13 chromosome 13q14 region.
References
  • Lee EY, et al. (1986) Molecular cloning of the human esterase D gene, a genetic marker of retinoblastoma. Proc Natl Acad Sci. 83(17):6337-41.
  • Lee EY, et al. (1988) Human esterase D gene: complete cDNA sequence, genomic structure, and application in the genetic diagnosis of human retinoblastoma. Hum Genet. 79(2): 137-41.
  • Saito S, et al. (2003) Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population. J Hum Genet. 48(5): 249-70.
  • TOP