Mouse ESM1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGC592-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
555bp
Gene Synonym
ESM-1, AV004503, 0610042H23Rik, Esm1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse endothelial cell-specific molecule 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ESM1 is a secreted protein which is produced by adipocytes. It has been noticed that ESM1 may play some role in obesity-associated vascular disease since circulating ESM-1 levels are reduced in the overweight and obese. ESM1 is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of ESM1 gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. Recently, ESM1 has been described as a specific biomarker of tip cells during neoangiogenesis. Its expression has been shown to be increase in presence of pro-angiogenic growth factors such as VEGF or FGF-2. In hypervascularized cancers, overexpression of endocan has been detected by immunohistochemistry using monoclonal antibodies against ESM1.
References
  • Cong R, et al. (2006) Hhex is a direct repressor of endothelial cell-specific molecule 1 (ESM-1). Biochem. Biophys Res Commun. 346(2):535-45.
  • Aitkenhead M, et al. (2002) Identification of endothelial cell genes expressed in an in vitro model of angiogenesis: induction of ESM-1, (beta)ig-h3, and NrCAM. Microvasc Res. 63(2): 159-71.
  • Lassalle P, et al. (1996) ESM-1 is a novel human endothelial cell-specific molecule expressed in lung and regulated by cytokines. J Biol Chem. 271(34):20458-64.
  • TOP