Rat ERP72 / PDIA4 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGC589-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1932bp
Gene Synonym
Erp70, Erp72, ERp-72
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat protein disulfide isomerase family A, member 4 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ERP72, also known as PDIA4, is an endoplasmic reticulum luminal protein which belongs to the protein disulfide isomerase family. ERP72 is a stress protein and participates in the catalysis of protein-S-S-bond rearrangement. Both of PDIA4 and PDIA3 function as proteases, protein disulfide isomerases, phospholipases or an arrangement of these. ERP72 compose part of a large chaperone multiprotein complex comprising CABP1, DNAJB11, HSP90B1, HSPA5, HYOU, PDIA2, PDIA4, PPIB, SDF2L1, UGT1A1 and very small amounts of ERP29, but not, or at very low levels, CALR nor CANX.
References
  • Tsai YC, et al. (2012) Functional proteomics establishes the interaction of SIRT7 with chromatin remodeling complexes and expands its role in regulation of RNA polymerase I transcription. Mol Cell Proteomics. 11(5):60-76.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Vinayagam A, et al. (2011) A directed protein interaction network for investigating intracellular signal transduction. Sci Signal. 4(189):rs8.
  • TOP