Rat Ephrin-B1/EFNB1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_017089.2

RefSeq ORF Size

1038bp

Gene Synonym

LERK2, Efnb1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat ephrin B1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Ephrin-B1 also known as EFNB1, is a member of the ephrin family. The transmembrane- associated ephrin ligands and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Eph receptors and ephrins are divided into two subclasses, A and B, based on binding specificities. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. EphrinB1 and B class Eph receptors provide positional cues required for the normal morphogenesis of skeletal elements. Another malformation, preaxial polydactyly, was exclusively seen in heterozygous females in which expression of the X-linked ephrinB1 gene was mosaic, so that ectopic EphB-ephrinB1 interactions led to restricted cell movements and the bifurcation of digital rays.

References

Davy A, et al. (2004) Ephrin-B1 forward and reverse signaling are required during mouse development. Genes Dev. 18(5): 572-83.

Compagni A, et al. (2003) Control of skeletal patterning by ephrinB1-EphB interactions. Dev Cell. 5(2): 217-30.

Wieland I, et al. (2004) Mutations of the ephrin-B1 gene cause craniofrontonasal syndrome. Am J Hum Genet. 74(6): 1209-15.

Catalog Number:MGC553-NF