Mouse EphB1/Eph Receptor B1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGC542-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2955bp
Gene Synonym
Elk, Net, Cek6, Elkh, Hek6, AW488255, 9330129L11, C130099E04Rik, ENSMUSG00000074119, Ephb1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Eph receptor B1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ephrin type-B receptor 1, also known as EphB1, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. EphB2 receptor tyrosine kinase phosphorylates syndecan-2 and that this phosphorylation event is crucial for syndecan-2 clustering and spine formation. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. EphB receptor tyrosine kinases are enriched at synapses, suggesting that these receptors play a role in synapse formation or function. We find that EphrinB binding to EphB induces a direct interaction of EphB with NMDA-type glutamate receptors. This interaction occurs at the cell surface and is mediated by the extracellular regions of the two receptors, but does not require the kinase activity of EphB.
References
  • Dalva MB, et al. (2000) EphB receptors interact with NMDA receptors and regulate excitatory synapse formation. Cell. 103(6): 945-56.
  • Takasu MA, et al. (2002) Modulation of NMDA receptor-dependent calcium influx and gene expression through EphB receptors. Science. 295(5554): 491-5.
  • Adams RH, et al. (1999) Roles of ephrinB ligands and EphB receptors in cardiovascular development: demarcation of arterial/venous domains, vascular morphogenesis, and sprouting angiogenesis. Genes Dev. 13(3): 295-306.
  • TOP