Mouse EphA1/Eph Receptor A1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGC536-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2934bp
Gene Synonym
Eph, Esk, AL033318, 5730453L17Rik, Epha1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Eph receptor A1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
EPHA1 or EPH receptor A1 belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. An important role of Eph receptors and their ligands ephrins is to mediate cell-contact-dependent repulsion. Eph receptors and ephrins also act at boundaries to channel neuronal growth cones along specific pathways, restrict the migration of neural crest cells, and via bidirectional signaling prevent intermingling between hindbrain segments. Eph receptors and ephrins can also trigger an adhesive response of endothelial cells and are required for the remodeling of blood vessels. Eph receptors and ephrins have emerged as key regulators of the repulsion and adhesion of cells that underlie the establishment, maintainence, and remodeling of patterns of cellular organization. The ephrins and Eph receptors are implicated as positional labels that may guide the development of neural topographic maps.
References
  • Flanagan JG, et al. (1998) THE EPHRINS AND EPH RECEPTORS IN NEURAL DEVELOPMENT. Annual Review of Neuroscience. 21: 309-45.
  • Wilkinson DG (2000) Eph receptors and ephrins: Regulators of guidance and assembly. International Review of Cytology. 196: 177-244.
  • Zhou R. (1998) The Eph family receptors and ligands. Pharmacol. 77 (3): 151-81.
  • TOP