Mouse ENTPD5 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGC523-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1284bp
Gene Synonym
Pcph, Cd39l4, mNTPase, AI196558, AI987697, NTPDase5, ER-UDPase, NTPDase-5, Entpd5
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse ectonucleoside triphosphate diphosphohydrolase 5 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5), also known as CD39 antigen-like 4, ER-UDPase, Guanosine-diphosphatase ENTPD5, Nucleoside diphosphatase Uridine-diphosphatase ENTPD5. This hydrolase is expressed in response to phosphoinositide 3-kinase (PI3K) signaling. Activation of PI3K results in FOXO phosphorylation by AKT1 and loss of ENTPD5 transcriptional repression. It is Up-regulated in PTEN-deficient cells. Uridine diphosphatase (UDPase) that promotes protein N-glycosylation and ATP level regulation.ENTPD5 promotes protein N-glycosylation and folding in the endoplasmic reticulum, as well as elevated ATP consumption in the cytosol via an ATP hydrolysis cycle. Together with CMPK1 and AK1, ENTPD5 constitutes an ATP hydrolysis cycle that converts ATP to AMP and results in a compensatory increase in aerobic glycolysis. ENTPD5 also hydrolyzes GDP and IDP but not any other nucleoside di-, mono- or triphosphates, nor thiamine pyrophosphate. This enzyme Plays a key role in the AKT1-PTEN signaling pathway by promoting glycolysis in proliferating cells in response to phosphoinositide 3-kinase (PI3K) signaling.
References
  • Villar J, et al. (2009) PCPH/ENTPD5 expression confers to prostate cancer cells resistance against cisplatin-induced apoptosis through protein kinase Calpha-mediated Bcl-2 stabilization. Cancer Res. 69(1): 102-10.
  • Fang M, et al. (2010) The ER UDPase ENTPD5 promotes protein N-glycosylation, the Warburg effect, and proliferation in the PTEN pathway. Cell. 143(5): 711-24.
  • Paez JG, et al. (2001) Identity between the PCPH proto-oncogene and the CD39L4 (ENTPD5) ectonucleoside triphosphate diphosphohydrolase gene. Int J Oncol. 19(6): 1249-54.
  • TOP