Rat Endothelial Cell Adhesion Molecule Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:MGC504-NG

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1185bp
Gene Synonym
MGC94065, Esam
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat endothelial cell adhesion molecule Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Endothelial cell-selective adhesion molecule (ESAM) is a member of JAM family of immunoglobulin superfamily and consists of one V-type and one C2-type immunoglobulin domain, as well as a hydrophobic signal sequence, a single transmembrane region, and a cytoplasmic domain. It is specifically expressed at endothelial tight junctions and on activated platelets. ESAM at endothelial tight junctions participates in the migration of neutrophils through the vessel wall, possibly by influencing endothelial cell contacts. The adaptor protein membrane-associated guanylate kinase MAGI-1 has been identified as an intracellular binding partner of ESAM. Previous studies have indicated that ESAM regulates angiogenesis in the primary tumor growth and endothelial permeability. It suggest that ESAM has a redundant functional role in physiological angiogenesis but serves a unique and essential role in pathological angiogenic processes such as tumor growth.
References
  • Ishida T, et al. (2003) Targeted disruption of endothelial cell-selective adhesion molecule inhibits angiogenic processes in vitro and in vivo. J Biol Chem. 278(36): 34598-604.
  • Wegmann F, et al. (2004) Endothelial adhesion molecule ESAM binds directly to the multidomain adaptor MAGI-1 and recruits it to cell contacts. Exp Cell Res. 300(1): 121-33.
  • Wegmann F, et al. (2006) ESAM supports neutrophil extravasation, activation of Rho, and VEGF-induced vascular permeability. J Exp Med. 203(7): 1671-7.
  • Hara T, et al. (2009) Endothelial cell-selective adhesion molecule regulates albuminuria in diabetic nephropathy. Microvasc Res. 77(3): 348-55.
  • Cangara HM, et al. (2010) Role of endothelial cell-selective adhesion molecule in hematogeneous metastasis. Microvasc Res. 80(1): 133-41.
  • TOP