Mouse ELA2/Neutrophil Elastase Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGC462-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
798bp
Gene Synonym
NE, F430011M15Rik, Ela2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse elastase, neutrophil expressed Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Neutrophil elastase, also known as Elastase-2, Bone marrow serine protease, Medullasin, ELANE, and ELA2, is a serine proteinase in the same family as chymotrypsin and has broad substrate specificity. Secreted by neutrophils during inflammation, it destroys bacteria and host tissue. As with other serine proteinases, ELANE / ELA2 contains a charge relay system composed of the catalytic triad of histidine, aspartate, and serine residues that are dispersed throughout the primary sequence of the polypeptide but that are brought together in the three dimension conformation of the folded protein. ELANE / ELA2 is an important protease enzyme that when expressed aberrantly can cause emphysema or emphysematous changes. This involves breakdown of the lung structure and increased airspaces. Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. ELANE / ELA2 hydrolyzes proteins within specialized neutrophil lysosomes, called azurophil granules, as well as proteins of the extracellular matrix following the protein's release from activated neutrophils. ELANE / ELA2 may play a role in degenerative and inflammatory diseases by its proteolysis of collagen-IV and elastin of the extracellular matrix. ELANE / ELA2 degrades the outer membrane protein A (OmpA) of E. coli as well as the virulence factors of such bacteria as Shigella, Salmonella and Yersinia. Defects in ELANE are a cause of cyclic haematopoiesis (CH), also known as cyclic neutropenia. CH is an autosomal dominant disease in which blood-cell production from the bone marrow oscillates with 21-day periodicity. Defects in ELANE are also the cause of autosomal dominant severe congenital neutropenia type 1 (SCN1) which is a heterogeneous disorder of hematopoiesis.
References
TOP