Human EG-VEGF / prokineticin-1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGC410-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
318bp
Gene Synonym
PROK1, PK1, PRK1, EGVEGF
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human prokineticin 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
EG-VEGF, also known as prokineticin-1, is a member of the AVIT (prokineticin) family. Prokineticins are secreted proteins that can promote angiogenesis and induce strong gastrointestinal smooth muscle contraction. EG-VEGF can be detected in the steroidogenic glands, ovary, testis, adrenal and placenta. EG-VEGF has little or no effect on a variety of other endothelial and non-endothelial cell types. It induces proliferation, migration and fenestration (the formation of membrane discontinuities) in capillary endothelial cells derived from endocrine glands. It directly influences neuroblastoma progression by promoting the proliferation and migration of neuroblastoma cells. EG-VEGF may play a role in placentation. It may also function in normal and pathological testis angiogenesis. It positively regulates PTGS2 expression and prostaglandin synthesis.
References
  • Masuda Y, et al. (2002) Isolation and identification of EG-VEGF/prokineticins as cognate ligands for two orphan G-protein-coupled receptors. Biochem. Biophys. Res. Commun. 293 (1): 396-402.
  • Pasquali D. et al. (2006) The endocrine-gland-derived vascular endothelial growth factor (EG-VEGF)/prokineticin 1 and 2 and receptor expression in human prostate: Up-regulation of EG-VEGF/prokineticin 1 with malignancy. Endocrinology. 147 (9): 4245-51.
  • Ngan ES, et al. (2008) Prokineticin-1 (Prok-1) works coordinately with glial cell line-derived neurotrophic factor (GDNF) to mediate proliferation and differentiation of enteric neural crest cells. Biochim Biophys Acta. 1783 (3): 467-78.
  • Ngan ES, et al. (2007) Prokineticin-1 modulates proliferation and differentiation of enteric neural crest cells. Biochim Biophys Acta. 1773 (4): 536-45.
  • TOP