Rat EFNB2/Ephrin-B2 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:MGC407-NH

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1011bp
Gene Synonym
Efnb2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat ephrin B2 Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
EphrinB2 also known as EFNB2 is a member of the ephrin family. EphrinB2 is involved in establishing arterial versus venous identity and perhaps in anastamosing arterial and venous vessels at their junctions. The transmembrane-associated ephrin ligands and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Eph receptors and ephrins are divided into two subclasses, A and B, based on binding specificities. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. EphrinB2 expression progressively extends from the arterial endothelium to surrounding smooth muscle cells and to pericytes, suggesting that ephrin-B2 may play an important role during formation of the arterial muscle wall.
References
  • Wang HU, et al. (1998) Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell. 93(5): 741-53.
  • Gale NW, et al. (2001) Ephrin-B2 selectively marks arterial vessels and neovascularization sites in the adult, with expression in both endothelial and smooth-muscle cells. Dev Biol. 230(2): 151-60.
  • Shin D, et al. (2001) Expression of ephrinB2 identifies a stable genetic difference between arterial and venous vascular smooth muscle as well as endothelial cells, and marks subsets of microvessels at sites of adult neovascularization. Dev Biol. 230(2): 139-50.
  • TOP